pcxle hul addgene (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc pcxle hul addgene
Pcxle Hul Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 318 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcxle+hsk+addgene/pCXLE-hSK+(Plasmid+%2327078)/pm41871099-678-8-9
Average 96 stars, based on 318 article reviews

pcxle hul addgene - by Bioz Stars, 2026-10

96/100 stars

Images

Recombinant:

Article Title: Generation of human induced pluripotent stem cell line EURACi006-A and its isogenic gene-corrected line EURACi006-A-1 from an arrhythmogenic cardiomyopathy patient carrying the c.1643delG PKP2 mutation.
Article Snippet: .. The generation of iPSCs was also approved by Ethical Committee of the Province of South Tyrol (Nr.1/2014, 12/03/2014) and by the Leiden University Medical Centre ethics committee under the umbrella protocol P 13.080 “Parapluprotocol: hiPSC” Addgene/public access repository recombinant DNA sources’ disclaimers (if applicable) Plasmids used for reprogramming: pCXLE-hOCT3/4-shp53-F Addgene #27077 pCXLE-hSK Addgene #27078 pCXLE-hUL Addgene #27080 pCXLE-EGFP Addgene #27082 ..

Article Title: Effective cryopreservation of human brain tissue and neural organoids.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PAX6 Biolegend Cat# 901301; RRID: AB_2749901 NKX6.1 Developmental Studies Hybridoma Bank Cat# F55A12; RRID: AB_532379 MAP2 Cell Signaling Technology Cat# 4542S; RRID: AB_10693782 TBR1 Abcam Cat# ab31940; RRID: AB_2200219 CTIP2 Abcam Cat# ab18465; RRID: AB_2064130 SATB2 Abcam Cat# ab34735; RRID: AB_2301417 BRN2 GeneTex Cat# GTX114650; RRID: AB_10619683 RELN Medical & Biological Laboratories Cat# D223-3; RRID: AB_843523 NKX2.1 Abcam Cat# ab227574 Olig2 Millipore Cat# AB9610; RRID: AB_570666 RX Santa Cruz Cat# SC-271889; RRID: AB_10708730 Ki67 Invitrogen Cat# 14-5698-82; RRID: AB_10854564 Tuj-1 Biolegend Cat# 801201; RRID: AB_2313773 GAD67 Millipore Cat# MAB5406; RRID: AB_2278725 Hoxc9 Abcam Cat# ab50839; RRID: AB_880494 Caspase3 Cell Signaling Technology Cat# 9661S NeuN Abcam Cat# ab104224; RRID: AB_10711040 GFAP Abcam Cat# ab7260; RRID: AB_305808 OCT4 BD Biosciences Cat# 561555; RRID: AB_10715577 SOX2 Cell Signaling Technology Cat# 4900S SSEA4 Millipore Cat# MAB4304; RRID: AB_177629 TRA-1-60 Millipore Cat# MAB4360; RRID: AB_2119183 DAPI Sigma Cat# MBD0015 Alexa Fluor-conjugated donkey anti-mouse ThermoFisher Cat# A11001; RRID: AB_2534069 Alexa Fluor-conjugated donkey anti-rabbit ThermoFisher Cat# A11012; RRID: AB_2534079 Alexa Fluor-conjugated donkey anti-rat Invitrogen Cat# A21208; RRID: AB_2535794 Chemicals, peptides, and recombinant proteins Methylcellulose Macklin Cat# C6333 Polyvinylpyrrolidone Aladdin Cat# P110607 Ethylene glycol Guoyao Cat# 107-21-1 Trehalose Yuanye Biotech Cat# S11052 Proline Sangon Biotech Cat# A600923 Glucose Diamond Biotech Cat# A100188 Sucrose Guoyao Cat# 10021463 Dimethyl sulfoxide Sigma-Aldrich Cat# D8418 SAG MedChemExpress Cat# HY-12848 Matrigel Corning Cat# 356230 EGF R&D Systems Cat# 236-EG-200 FGF PeproTech Cat# AF-100-18B FGF8 PeproTech Cat# AF-100-25 b-mercaptoethanol Sigma-Aldrich Cat# M3148 LDN193189 MedChemExpress Cat# HY-12071 SB431542 MedChemExpress Cat# HY-10431 CHIR99021 Tocris Cat# 4423 (Continued on next page) e1 Cell Reports Methods 4, 100777, May 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Y27632 MedChemExpress Cat# HY-10583 B27 Gibco Cat# 17504044 B27(-VA) Gibco Cat# 12587010 N2 ThermoFisher Cat# 17502048 RA Sigma-Aldrich Cat# R2625 BMP4 PeproTech Cat# 120-05-5 GDNF PeproTech Cat# AF-450-10 BDNF PeproTech Cat# AF-450-02-10 Vitamin C Sigma-Aldrich Cat# A8960 IWP2 MedChemExpress Cat# HY-13912 Insulin Sigma-Aldrich Cat# I3536 Papain enzyme Worthington Cat# LS03126 DNase I Sigma-Aldrich Cat# 11284932001 L-cysteine salt Sigma-Aldrich Cat# C7880 CalbryteTM 590 a.m. AAT Bioquest Cat# 20700 KCl Innochem Cat# A44772 NBQX Macklin Cat# N873840 Critical commercial assays Nucleofector kit Lonza Cat# VPD-1001 Deposited data 10x Single-cell RNA-sequencing data https://ngdc.cncb.ac.cn/gsa-human/ Accession: HRA004281 RNA sequencing data https://ngdc.cncb.ac.cn/gsa-human/ Accession: HRA004275 Experimental models: Cell lines Human embryonic stem cell line (H9) Wicell Agreement No. 22-W0510 Recombinant DNA pCXLE-hOCT3/4-shp53-F Addgene Cat# 27077 pCXLE-hSK Addgene Cat# 27078 pCXLE-hUL Addgene Cat# 27080 Software and algorithms Graphpad Prism 8.0 Graphpad software https://www.graphpad.com/ ImageJ 2.1.0/1.53c ImageJ software https://imagej.net/Contributors ..

Article Title: Rescue of α-synuclein aggregation in Parkinson's patient neurons by synergistic enhancement of ER proteostasis and protein trafficking.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Quantitative RT-PCR: GAPDH (ID: Hs02758991_g1) Thermo Fisher Scientific Cat #4331182 QuikChange XL Site-Directed Mutagenesis Kit Agilent Cat #200517 Deposited Data Raw western blot images Mendeley Mendeley Data: https://doi.org/10.17632/ 29t6p4wrs7.1 Experimental models: Cell lines H4 neuroglioma cells Mazzulli et al., 2011; From: Pamela McLean (Mayo Clinic, Jacksonville, Florida, USA) N/A GM15010 (SNCA Triplication, 3x-1) This paper; clinical and other information can be obtained from the Coriell Cell Repository N/A ND00196 (SNCA Triplication, 3x-2) This paper; clinical and other information can be obtained from the Coriell Cell Repository N/A ND00139 (SNCA Triplication, 3x-4) This paper; clinical and other information can be obtained from the Coriell Cell Repository N/A ND34391 (SNCA Triplication, Est. .. Mazzulli et al., 2016; Zunke et al., 2018; Cuddy et al., 2019; Coriell Cell Repository N/A GM00852, GD patient (N370S / 84GG) Mazzulli et al., 2011; Mazzulli et al., 2016; Coriell Cell Repository N/A ND34982, GBA1-PD heterozygote (N370S / WT) Coriell Cell Repository N/A GD patient L444P / L444P (Schöndorf et al., 2014) N/A A53T alpha-synuclein and isogenic control Soldner et al., 2011 N/A Oligonucleotides See Table S4 N/A Recombinant DNA pCXLE-hOCT3/4-shp53-F Addgene, (Okita et al., 2011) Cat #27077 pCXLE-hUL Addgene, (Okita et al., 2011) Cat #27080 pCXLE-hSK Addgene, (Okita et al., 2011) Cat #27078 PITX3-2A-eGFP-PGK-Puro Addgene, (Hockemeyer et al., 2011) Cat #31943 Cas9-nickase plasmid PX335 Addgene, (Nora et al., 2017) Cat #42335 pLKO.1 RyR3 shRNA (clone ID #TRCN0000053349) Sigma Cat #NM_001036 pER4-ykt6-CS This paper N/A pER4-GBA1 L444P This paper N/A Software and algorithms GraphPad Prism V6.0 software GraphPad https://www.graphpad.com/scientific- software/prism/: ImageJ / Fiji V1.0 software National Institutes of Health https://imagej.net/software/fiji/ Nikon NIS Elements Nikon https://www.microscope.healthcare.nikon. com/products/software/nis-elements Odyssey software (Image Studio V3.1.4) Li-Cor Biosciences https://www.licor.com/bio/image-studio/ Snapgene V5.3 software SnapGene https://www.snapgene.com Other Concanavalin-A, biotinylated Vector Laboratories Cat #B-1005-5 DAPI Fluoromount mounting media Southern Biotech Cat #0100-20 (Continued on next page) Neuron 110, 436–451.e1–e11, February 2, 2022 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Intercept blocking buffer Li-Cor Biosciences Cat #927-70001 Lenti-X concentrator Clontech Cat #631232 Lipofectamine 3000 Thermo Fisher Scientific Cat #L3000008 Matrigel Fisher Cat #CB-40234 mTeSR1 media StemCell Technologies Cat #85850 Neurobasal SM1 media Thermo Fisher Scientific Cat #21103-049 NeuroCult SM1 supplement: StemCell Technologies Cat #05711 NeutrAvidin agarose beads Thermo Fisher Scientific Cat #29204 PVDF transfer membrane, 0.45 mm pore size Millipore Cat #IPFL00010 X-tremeGENE HP DNA Transfection Reagent Roche Cat #6366236001

Single Cell:

RNA sequencing:

RNA Sequencing:

Software:

other:

Article Title: Genetic resiliency associated with dominant lethal TPM1 mutation causing atrial septal defect with high heritability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Human TPM1 primers for variant confirmation Forward: GTCATATCCACCGTCAACTGG This paper N/A Human TPM1 primers for variant confirmation Reverse: ACCTGCTTGCTCCTGTCTTC This paper N/A Human TLN2 primers for variant confirmation Forward: GAGTCTGGGACTGCCCAAT This paper N/A Human TLN2 primers for variant confirmation Reverse: CCAGGACAGCTAGAGGGACA This paper N/A Mouse Tpm1 Primers for mouse CRISPR genotyping Forward: TCCTAAGGAATGCGGTCGCCC This paper N/A Mouse Tpm1 Primers for mouse CRISPR genotyping Reverse: AGTCAGAGAAGGGCCACGAGC This paper N/A Mouse Tln2 Primers for mouse CRISPR genotyping Forward: AGACCAGAGTACCCAGCACTGC This paper N/A Mouse Tln2 Primers for mouse CRISPR genotyping Reverse: CCCAGGCGTGTTCTTTCTGCC This paper N/A X.tropicalis Tpm1 CRISPR target region genotyping Forward: CCCAGGGCTCAGACTAGGAA This paper N/A X.tropicalis Tpm1 CRISPR target region genotyping Reverse: TTGAGACAGGTCCTTGGGGG This paper N/A X.laevis Tpm1 Morpholino oligo sequence: CATCTTCTTCTTGATGGCGTCCATG This paper N/A X.tropicalis Tpm1 CRISPR sgRNA 1 Forward: TAGGCCTTGGACAGAGCAGAAC This paper N/A X.tropicalis Tpm1 CRISPR sgRNA 1 Reverse: AAACGTTCTGCTCTGTCCAAGG This paper N/A Mouse Tpm1 CRISPR sgRNA: CTTCTTGATGGCGTCCATGG This paper N/A Mouse Tpm1 CRISPR single-stranded donor: TCCGCTGCCTAAG GGCCCCTCGCCACCGCCACCATGGACGCCATC AAGAAGATGCAGATGCTGAAGCTCGACAAAGAGAACG CCTTGGATCGAGCTGAGCAAGCGGAGGCTGATAAGAAGGCGGC This paper N/A Mouse Tln2 CRISPR sgRNA: AGGTGCGAACCAGAGCCTTG This paper N/A Mouse Tln2 CRISPR single-stranded donor: CACCCCACCCTGCCCATACCCCTCCTTACCACCAAGACGTGTT CTAGTAGGTCCAGGTAGCCCAAGGTGCATTCTGTGCCATA ATGCAAGGCTCTGGTTCGCACCTCTTCACTGACATCAGGGTA This paper N/A Recombinant DNA DR274 vector Addgene #42250 pCXLE-hOCT3/4-shp53-F Addgene #27077 pCXLE-hSK Addgene #27078 pCXLE-hUL Addgene #27080 pCXLE-EGFP Addgene #27082 Software and algorithms Graph Pad Prism GraphPad Software GraphPad Prism, RRID:SCR_002798 ZiFiT targeter Sander et al.41 http://zifit.partners.org/ZiFiT/ ImageJ ImageJ ImageJ, RRID: SCR_003070 LASX Leica Application Suite X Leica Application Suite X, RRID:SCR_013673 R (v3.6.0) R Core R Project for Statistical Computing, RRID: SCR_001905 (Continued on next page) e2 Cell Reports Medicine 3, 100501, February 15, 2022

Article Title: Genetic resiliency associated with dominant lethal TPM1 mutation causing atrial septal defect with high heritability
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Human TPM1 primers for variant confirmation Forward: GTCATATCCACCGTCAACTGG This paper N/A Human TPM1 primers for variant confirmation Reverse: ACCTGCTTGCTCCTGTCTTC This paper N/A Human TLN2 primers for variant confirmation Forward: GAGTCTGGGACTGCCCAAT This paper N/A Human TLN2 primers for variant confirmation Reverse: CCAGGACAGCTAGAGGGACA This paper N/A Mouse Tpm1 Primers for mouse CRISPR genotyping Forward: TCCTAAGGAATGCGGTCGCCC This paper N/A Mouse Tpm1 Primers for mouse CRISPR genotyping Reverse: AGTCAGAGAAGGGCCACGAGC This paper N/A Mouse Tln2 Primers for mouse CRISPR genotyping Forward: AGACCAGAGTACCCAGCACTGC This paper N/A Mouse Tln2 Primers for mouse CRISPR genotyping Reverse: CCCAGGCGTGTTCTTTCTGCC This paper N/A X.tropicalis Tpm1 CRISPR target region genotyping Forward: CCCAGGGCTCAGACTAGGAA This paper N/A X.tropicalis Tpm1 CRISPR target region genotyping Reverse: TTGAGACAGGTCCTTGGGGG This paper N/A X.laevis Tpm1 Morpholino oligo sequence: CATCTTCTTCTTGATGGCGTCCATG This paper N/A X.tropicalis Tpm1 CRISPR sgRNA 1 Forward: TAGGCCTTGGACAGAGCAGAAC This paper N/A X.tropicalis Tpm1 CRISPR sgRNA 1 Reverse: AAACGTTCTGCTCTGTCCAAGG This paper N/A Mouse Tpm1 CRISPR sgRNA: CTTCTTGATGGCGTCCATGG This paper N/A Mouse Tpm1 CRISPR single-stranded donor: TCCGCTGCCTAAG GGCCCCTCGCCACCGCCACCATGGACGCCATC AAGAAGATGCAGATGCTGAAGCTCGACAAAGAGAACG CCTTGGATCGAGCTGAGCAAGCGGAGGCTGATAAGAAGGCGGC This paper N/A Mouse Tln2 CRISPR sgRNA: AGGTGCGAACCAGAGCCTTG This paper N/A Mouse Tln2 CRISPR single-stranded donor: CACCCCACCCTGCCCATACCCCTCCTTACCACCAAGACGTGTT CTAGTAGGTCCAGGTAGCCCAAGGTGCATTCTGTGCCATA ATGCAAGGCTCTGGTTCGCACCTCTTCACTGACATCAGGGTA This paper N/A Recombinant DNA DR274 vector Addgene #42250 pCXLE-hOCT3/4-shp53-F Addgene #27077 pCXLE-hSK Addgene #27078 pCXLE-hUL Addgene #27080 pCXLE-EGFP Addgene #27082 Software and algorithms Graph Pad Prism GraphPad Software GraphPad Prism, RRID:SCR_002798 ZiFiT targeter Sander et al.41 http://zifit.partners.org/ZiFiT/ ImageJ ImageJ ImageJ, RRID: SCR_003070 LASX Leica Application Suite X Leica Application Suite X, RRID:SCR_013673 R (v3.6.0) R Core R Project for Statistical Computing, RRID: SCR_001905 (Continued on next page) e2 Cell Reports Medicine 3, 100501, February 15, 2022 Article ll OPEN ACCESS

In Vivo:

Article Title: The insertion of an ATTTC repeat in an Alu element hyperactivates a neurodevelopmental enhancer in spinocerebellar ataxia type 37.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines Control iPS cell line GM23280 Coriell Institute Cat #GM23280 Control iPS cell line NAS6 gift from Dr T. Kunath, University of Edinburgh; Ludtmann et al.60 N/A Control iPS cell line ND41866 Coriell Institute Cat #ND41866 Fibroblast cell line AF2 Seixas et al.8 N/A Fibroblast cell line AF3 Seixas et al.8 N/A Fibroblast cell line AF4 Seixas et al.8 N/A Human embryonic kidney 293T (HEK293T) cell line ATCC Cat #CRL-3216 Human neural stem cells (hNCS) Sun et al.61 N/A SCA37 iPS cell line AF2Cl21 This study N/A SCA37 iPS cell line AF2Cl4 This study N/A SCA37 iPS cell line AF3Cl7 This study N/A SCA37 iPS cell line AF4Cl32 This study N/A Experimental models: organisms/strains Transgenic zebrafish line gSA2AzGFF152B; UAS:GFP Kindly gift by Drs. Kawakami and Hibi, Japan; Takeuchi et al.47; Asakawa et al.62 N/A Transgenic zebrafish line Tg(Frag1:EGFP) This study N/A Transgenic zebrafish line Tg(Frag3:EGFP) This study N/A Transgenic zebrafish line Tg(FragT:EGFP) This study N/A Zebrafish WTAB This study N/A Oligonucleotides Primers for 4C-seq are provided in Table S2 This study N/A Primers for cloning FragT and subfragments in pMCS or Topo8 are provided in Table S2 This study N/A Primers for cloning TK promoter in pGL4.23-GW are provided in Table S2 This study N/A Primers for genotyping of HEK293T cell clones are provided in Table S2 This study N/A Primers for qPCR are provided in Table S2 This study N/A SgRNAs used for FragT deletion are provided in Table S3 This study N/A Recombinant DNA .. pCXLE-hOCT3/4 Addgene Cat #27076 pCXLE-hSK Addgene Cat #27078 pCXLE-hUL Addgene Cat #27080 In vivo DRL/FragT activity 1GWC2EGFP Regadas et al.34 Available upon request 1GWC2EGFP-Frag1-AS This study Available upon request 1GWC2EGFP-Frag3-AS This study Available upon request 1GWC2EGFP-FragT14-AS This study Available upon request 1GWC2EGFP-FragT14-S This study Available upon request In vivo DRL/FragT interaction with Z48 midbrain enhancer pminiTOL_MCS(pUC19)-GW-GFP-Z48 Regadas et al.34 Available upon request pminiTOL_MCS(pUC19)-GW-GFP-Z48Frag1-AS This study Available upon request pminiTOL_MCS(pUC19)-GW-GFP-Z48Frag3-AS This study Available upon request (Continued on next page) Cell Reports 45, 117146, April 28, 2026 23 .. REAGENT or RESOURCE SOURCE IDENTIFIER pminiTOL_MCS(pUC19)-GW-GFP-Z48FragT14-AS This study Available upon request In vivo silencer assay pminiTol2-Z48-GW-CARGFP Bessa et al.40 N/A pminiTol2-Z48-GW-CARGFP-Frag1-S This study Available upon request pminiTol2-Z48-GW-CARGFP-Frag3-S This study Available upon request pminiTol2-Z48-GW-CARGFP-FragT14-S This study Available upon request pminiTol2-Z48-GW-CARGFP-FragT-S-MA This study Available upon request Luciferase assays In vitro FragT/DRL activity pGL3/GW This study Available upon request pGL3-Basic Promega Cat #E175A pGL3-Frag1-AS This study Available upon request pGL3-Frag3-AS This study Available upon request pGL3-FragT126-AS This study Available upon request pGL3-FragT14-AS This study Available upon request pGL3-FragT14-S This study Available upon request pGL3-FragT-AS-MA This study Available upon request pGL3-TK This study Available upon request pNL1.1TK[Nluc/TK] vector (used also in ‘‘in vitro silencer assay’’ and ‘‘in vitro enhancer assay’’) Promega Cat #N1501 In vitro silencer assay pGL4.23 GW[luc2/minP] vector Addgene Cat #60323 pGL4.23 GW[luc2/Tk] vector This study Available upon request pGL4.23-Frag1-S This study Available upon request pGL4.23-Frag2-S This study Available upon request pGL4.23-Frag3-S This study Available upon request pGL4.23-FragT126-S This study Available upon request pGL4.23-FragT14-S This study Available upon request pGL4.23-FragT-S-MA This study Available upon request In vivo enhancer assay ZED Bessa et al.40 N/A ZED-FragT14-S This study Available upon request ZED-FragT-S-MA This study Available upon request In vitro enhancer assay pGL4.23 GW[luc2/minP] vector Addgene Cat #60323 pGL4.23 GW[luc2/Tk] vector This study Available upon request pGL4.23-Frag1+2-S This study Available upon request pGL4.23-Frag1-S This study Available upon request pGL4.23-Frag2+3-S This study Available upon request pGL4.23-Frag2+CpG-S This study Available upon request pGL4.23-Frag2-S This study Available upon request pGL4.23-Frag2-S-MA This study Available upon request pGL4.23-Frag3-S This study Available upon request pGL4.23-FragT14-S This study Available upon request pGL4.23-FragT-S-MA This study Available upon request Entry vectors for non-pathogenic alleles (Continued on next page) 24 Cell Reports 45, 117146, April 28, 2026

Review

pcxle hul addgene (Addgene inc)

Structured Review

Images

Related Articles

Recombinant:

Single Cell:

RNA sequencing:

RNA Sequencing:

Software:

other:

In Vivo:

Activity Assay:

Control:

Plasmid Preparation:

shRNA:

Similar Products

Image Search Results